two step detection kit Search Results


curve rt qpcr  (PCR Biosystems Ltd)
95
PCR Biosystems Ltd curve rt qpcr
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Curve Rt Qpcr, supplied by PCR Biosystems Ltd, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/curve rt qpcr/product/PCR Biosystems Ltd
Average 95 stars, based on 1 article reviews
curve rt qpcr - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier
two step rtpcr kit  (RNAConnect Inc)
93
RNAConnect Inc two step rtpcr kit
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Two Step Rtpcr Kit, supplied by RNAConnect Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/two step rtpcr kit/product/RNAConnect Inc
Average 93 stars, based on 1 article reviews
two step rtpcr kit - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier
carboxyphenol ba  (Chem Impex International)
95
Chem Impex International carboxyphenol ba
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Carboxyphenol Ba, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/carboxyphenol ba/product/Chem Impex International
Average 95 stars, based on 1 article reviews
carboxyphenol ba - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier
mouse two-step detection kit  (ZSGB Biotech)
90
ZSGB Biotech mouse two-step detection kit
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Mouse Two Step Detection Kit, supplied by ZSGB Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse two-step detection kit/product/ZSGB Biotech
Average 90 stars, based on 1 article reviews
mouse two-step detection kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
biotinylated secondary antirabbit antibody  (ZSGB Biotech)
90
ZSGB Biotech biotinylated secondary antirabbit antibody
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Biotinylated Secondary Antirabbit Antibody, supplied by ZSGB Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/biotinylated secondary antirabbit antibody/product/ZSGB Biotech
Average 90 stars, based on 1 article reviews
biotinylated secondary antirabbit antibody - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
two-step rt-pcr kit  (KangChen Inc)
90
KangChen Inc two-step rt-pcr kit
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Two Step Rt Pcr Kit, supplied by KangChen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/two-step rt-pcr kit/product/KangChen Inc
Average 90 stars, based on 1 article reviews
two-step rt-pcr kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
two-step reverse transcription kit  (Promega)
90
Promega two-step reverse transcription kit
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Two Step Reverse Transcription Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/two-step reverse transcription kit/product/Promega
Average 90 stars, based on 1 article reviews
two-step reverse transcription kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
ultra sybr two step qrt-pcr kit (with rox)  (Beijing CWBio)
90
Beijing CWBio ultra sybr two step qrt-pcr kit (with rox)
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Ultra Sybr Two Step Qrt Pcr Kit (With Rox), supplied by Beijing CWBio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ultra sybr two step qrt-pcr kit (with rox)/product/Beijing CWBio
Average 90 stars, based on 1 article reviews
ultra sybr two step qrt-pcr kit (with rox) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
enhenced enzyme-labeled goat anti-mouse/rabbit igg antibody pv900  (ZSGB Biotech)
90
ZSGB Biotech enhenced enzyme-labeled goat anti-mouse/rabbit igg antibody pv900
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Enhenced Enzyme Labeled Goat Anti Mouse/Rabbit Igg Antibody Pv900, supplied by ZSGB Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/enhenced enzyme-labeled goat anti-mouse/rabbit igg antibody pv900/product/ZSGB Biotech
Average 90 stars, based on 1 article reviews
enhenced enzyme-labeled goat anti-mouse/rabbit igg antibody pv900 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
two-label, three-color detection kit  (ImmunoWay Biotechnology Company)
90
ImmunoWay Biotechnology Company two-label, three-color detection kit
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Two Label, Three Color Detection Kit, supplied by ImmunoWay Biotechnology Company, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/two-label, three-color detection kit/product/ImmunoWay Biotechnology Company
Average 90 stars, based on 1 article reviews
two-label, three-color detection kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
two steps kit  (Promega)
90
Promega two steps kit
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Two Steps Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/two steps kit/product/Promega
Average 90 stars, based on 1 article reviews
two steps kit - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
mouse/rabbit two-step detection kit pv-7000  (Beijing Zhong Ke San Huan High Tech Co Ltd)
90
Beijing Zhong Ke San Huan High Tech Co Ltd mouse/rabbit two-step detection kit pv-7000
( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute <t>RT-qPCR.</t> Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).
Mouse/Rabbit Two Step Detection Kit Pv 7000, supplied by Beijing Zhong Ke San Huan High Tech Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse/rabbit two-step detection kit pv-7000/product/Beijing Zhong Ke San Huan High Tech Co Ltd
Average 90 stars, based on 1 article reviews
mouse/rabbit two-step detection kit pv-7000 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute RT-qPCR. Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).

Journal: bioRxiv

Article Title: Species-specific barriers constrict Orsay virus host range across the Caenorhabditis genus

doi: 10.64898/2026.04.10.717618

Figure Lengend Snippet: ( A ) Schematic explanation of the experimental design. Synchronized populations of ∼500 worms were inoculated at hatching with 2.8×10 9 copies of OrV RNA2 and sampled at the indicated timepoints for total RNA extraction or single worm lysis and OrV viral load by measured by absolute RT-qPCR. Viral load over time throughout the first 44 hpi in the different host species: ( B ) C. elegans ERT54 (grey), ( C ) C. tropicalis (yellow), ( D ) C. wallacei (blue), ( E ) C. remanei (red), ( F ) C. macrosperma (green), and ( G ) C. sulstoni (pink). Viral load was measured as the number of OrV RNA2 copies in 10 ng of total RNA; 3 - 16 replicates per strain per timepoint. ( H ) Violin plots of OrV viral load of individual animals ( n = 24 for each species) at 24 hpi. Viral load was measured as the number of OrV RNA2 copies in 1/5 of the single worm lysate. Horizontal grey lines represent the technical detection limit (mean + 2SD of negative controls).

Article Snippet: OrV titers were quantified by standard curve RT-qPCR using the qPCRBIO SyGreen 1-Step Go Hi-ROX kit (PCR Biosystems Ltd., London, UK) on an ABI StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City CA, USA), with primers targeting a region of OrV RNA2 (5’ACGAAGCAGTAGCCGTTAAG3’ and 5’GAGAACATCCTTCTCTGCGG3’).

Techniques: RNA Extraction, Lysis, Quantitative RT-PCR